Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More
Learn More
Promega pUC/M13 Sequencing Primers
Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. They also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors.
$150.00
Specifications
Concentration | 10μg/mL |
---|---|
For Use With (Application) | For sequencing inserts cloned into the M13 vectors and pUC plasmids developed by messing |
Product Type | Primer |
Quantity | 2 μg |
Catalog Number | Mfr. No. | Sequence | Price | Quantity & Availability | |||||
---|---|---|---|---|---|---|---|---|---|
Catalog Number | Mfr. No. | Sequence | Price | Quantity & Availability | |||||
PRQ5601
|
Promega
Q5601 |
CGCCAGGGTTTTCCCAGTCACGAC |
Each of 1 for $150.00
|
|
|||||
Description
- Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids
- Can sequence other lacZ-containing plasmids such as the pGEM(R)-Z and pGEM(R)-Zf Vectors
- Supplied at a concentration of 10μg/ml
Specifications
10μg/mL | |
For sequencing inserts cloned into the M13 vectors and pUC plasmids developed by messing | |
Primer | |
2 μg |
Spot an opportunity for improvement?
Provide Content Correction
Provide Content Correction
We continue to work to improve your shopping experience and your feedback regarding this content is very important to us. Please use the form below to provide feedback related to the content on this product.
Product Title