Promega pUC/M13 Sequencing Primers

Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. They also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors.

Supplier:  Promega Q5601

Catalog No. PRQ5601

Description

• Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids
• Can sequence other lacZ-containing plasmids such as the pGEM(R)-Z and pGEM(R)-Zf Vectors
• Supplied at a concentration of 10μg/ml

Specifications

• Concentration: 10μg/mL
• Product Type: Primer
• Sequence: CGCCAGGGTTTTCCCAGTCACGAC

• For Use With (Application): For sequencing inserts cloned into the M13 vectors and pUC plasmids developed by messing
• Quantity: 2 μg