Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

Promega pUC/M13 Sequencing Primers

Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. They also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors.

Supplier:  Promega Q5601

 View more versions of this product

Catalog No. PRQ5601


Add to Cart

Description

Description

  • Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids
  • Can sequence other lacZ-containing plasmids such as the pGEM(R)-Z and pGEM(R)-Zf Vectors
  • Supplied at a concentration of 10μg/ml
Specifications

Specifications

10μg/mL
Primer
CGCCAGGGTTTTCCCAGTCACGAC
For sequencing inserts cloned into the M13 vectors and pUC plasmids developed by messing
2 μg
Recommendations

Recommendations

SDS
Documents

Documents

Product Certifications
Promotions

Promotions

Provide Content Correction

We continue to work to improve your shopping experience and your feedback regarding this content is very important to us. Please use the form below to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Cancel Submit