Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More
Learn More
Promega pTARGET™ Sequencing Primer
Designed for sequencing inserts cloned into the pTARGET™ Mammalian Expression Vector
Supplier: Promega Q4461
Description
- Designed for Sequencing Inserts Cloned into the pTargeT™ Mammalian Expression Vector
- Hybridizes to the region of the lacZ gene at nucleotides 1367-1344 on the pTargeT™ Vector
Specifications
10ng/μL | |
For sequencing inserts cloned into the pTARGET™ mammalian expression vector | |
2 μg |
-30°C to -10°C | |
Primer | |
TTACGCCAAGTTATTTAGGTGACA |
Provide Content Correction
We continue to work to improve your shopping experience and your feedback regarding this content is very important to us. Please use the form below to provide feedback related to the content on this product.
Product Title
Spot an opportunity for improvement?
Provide Content Correction