Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Supplier:  MilliporeSigma™ 1710032

Catalog No. 17-100-32MI


Add to cart

Description

Description

Specifically detects Trimethyl-Histone H3 (Lys36)α Clone: in Chicken, Human samples, and it is validated for ChIP, Dot Blot, Functional Assay, Western Blotting

Histones are highly conserved proteins that serve as the structural scaffold for the organization of nuclear DNA into chromatin. The four core histones, H2A, H2B, H3, and H4, assemble into an octamer (2 molecules of each). Subsequently, 146 base pairs of DNA are wrapped around the octamer, forming a nucleosome, the basic subunit of chromatin. Histones are modified post-translationally by the actions of enzymes in both the nucleus and cytoplasm. These modifications regulate DNA transcription, repair, recombination, and replication. The most commonly studied modifications are acetylation, phosphorylation, methylation, and ubiquitination. These modifications can alter local chromatin architecture, or recruit trans-acting factors that recognize specific histone modifications (the histone code hypothesis). The modifications occur predominantly on the N-terminal and C-terminal tails that extend beyond the nucleosome core particle. Methylation of histone H3 on Lys36 (H3K36me2/3) is tightly associated with actively transcribed genes, and this modification is found primarily within the coding region, suggesting H3K36 methylation is necessary for efficient RNA polymerase II elongation and processivity.
Specifications

Specifications

Trimethyl-Histone H3 (Lys36)α
Monoclonal
Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
KLH-conjugated, synthetic peptide containing the sequence ....GVme3KKP…, in which me3K corresponds to human trimethyl-histone H3 (Lys36).
25 Assays
Epigenetics, Nuclear Function
NP_003484
This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
IgG
ChIP assay, Dot Blot, Functional Assay, Western Blot
Unconjugated
Q16695
Rabbit
Protein A purified
RUO
Primary
Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.
Chicken, Human
Purified
SDS
Documents

Documents

Product Certifications
Promotions

Promotions

Provide Content Correction

We continue to work to improve your shopping experience and your feedback regarding this content is very important to us. Please use the form below to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Cancel Submit

For Research Use Only