Promotional price valid on web orders only. Your contract pricing may differ. Interested in signing up for a dedicated account number?
Learn More
Learn More
MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set
Rabbit Monoclonal Antibody
Supplier: MilliporeSigma™ 1710032
Description
Specifically detects Trimethyl-Histone H3 (Lys36)α Clone: in Chicken, Human samples, and it is validated for ChIP, Dot Blot, Functional Assay, Western Blotting
Histones are highly conserved proteins that serve as the structural scaffold for the organization of nuclear DNA into chromatin. The four core histones, H2A, H2B, H3, and H4, assemble into an octamer (2 molecules of each). Subsequently, 146 base pairs of DNA are wrapped around the octamer, forming a nucleosome, the basic subunit of chromatin. Histones are modified post-translationally by the actions of enzymes in both the nucleus and cytoplasm. These modifications regulate DNA transcription, repair, recombination, and replication. The most commonly studied modifications are acetylation, phosphorylation, methylation, and ubiquitination. These modifications can alter local chromatin architecture, or recruit trans-acting factors that recognize specific histone modifications (the histone code hypothesis). The modifications occur predominantly on the N-terminal and C-terminal tails that extend beyond the nucleosome core particle. Methylation of histone H3 on Lys36 (H3K36me2/3) is tightly associated with actively transcribed genes, and this modification is found primarily within the coding region, suggesting H3K36 methylation is necessary for efficient RNA polymerase II elongation and processivity.Specifications
Trimethyl-Histone H3 (Lys36)α | |
Monoclonal | |
Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT | |
H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945 | |
KLH-conjugated, synthetic peptide containing the sequence ....GVme3KKP…, in which me3K corresponds to human trimethyl-histone H3 (Lys36). | |
25 Assays | |
Epigenetics, Nuclear Function | |
NP_003484 | |
This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. | |
-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles | |
IgG |
ChIP Assay, Dot Blot, Functional Assay, Western Blot | |
Unconjugated | |
Q16695 | |
Rabbit | |
Protein A purified | |
RUO | |
Primary | |
Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa. | |
Chicken, Human | |
Purified |
Provide Content Correction
We continue to work to improve your shopping experience and your feedback regarding this content is very important to us. Please use the form below to provide feedback related to the content on this product.
Product Title
For Research Use Only
Spot an opportunity for improvement?
Provide Content Correction